Sequencing:Article Title: Zika Virus Encoding Nonglycosylated Envelope Protein Is Attenuated and Defective in Neuroinvasion
Article Snippet: The plasmid, which contains an inducible origin of replication from phage N15, can be maintained at approximately 2 to 4 copies/cell in the BigEasy TSA host strain (Lucigen Corporation). .. Further details of the BigEasy TSA host strain can be obtained from Lucigen Corporation or from the corresponding author. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′–3′) a Purpose 1F cggatc gacgtc TAATACGACTCACTATAG AGTTGTTGATCTGTGTGAGTCAGACTGCG Amplification of fragment A 5030R gagccg tcgcga GGATCGGAGATCCTGAGGTC CCTGCAGG GTAGT Amplification of fragment A 5003F ctctggactac CCTGCAGG GACGTCCGGAAGTCCGATCCTAGACAAATGTGG Amplification of fragment B 7190R catcattagca tcgcga CTCCAAGGTCCC ATGCAT AAAATGG Amplification of fragment B 7006F CATTGATCTGCGGCCAGC Amplification of fragment C 8860R gttgat tcgcga TTCTTTGGTGCAG ACGCGT GGCCGC Amplification of fragment C 8584F CCATGGGAGCTACGAAGC Amplification of fragment D 10807R gagact tcgcgagcgcgc AGAAACCATGGATTTCCCCACACCGGCCGCCGAAGTTCG GCGATCTGTGCCTGGC Amplification of fragment D POL-6126F CCTCGCTCTATCGG CCTGAGG CCGATAAG Polymerase mutation POL-9709R gacact CCTGAGG GCATGTGCAAACCTATCATCGATTGGCTTCACAACGCAGG CAGCTGCACTGACCGCCATTCGTTTG Polymerase mutation PJAZZ-10222F GCCCACCCGAAGGTGAG Glycosylation mutation GLY-1467R CTATTTTCGTCAGTTTCATATCCAATCATCCCGCTATGC VNDT deletion N154A CAGTTTCATATCCTGTATCAGCGACAATCATCCCGCTATG Glycosylation mutation GLY-3302R CTTCACTGTGCCATGGC Glycosylation mutation Tag-3902F GCTCTTGAAGGTGACTTG Detection of genetic tag Tag-5723R CATTTCCGTTTCTCACGC Detection of genetic tag Open in a separate window a Restriction enzyme sites are underlined. ..
Amplification:Article Title: Zika Virus Encoding Nonglycosylated Envelope Protein Is Attenuated and Defective in Neuroinvasion
Article Snippet: The plasmid, which contains an inducible origin of replication from phage N15, can be maintained at approximately 2 to 4 copies/cell in the BigEasy TSA host strain (Lucigen Corporation). .. Further details of the BigEasy TSA host strain can be obtained from Lucigen Corporation or from the corresponding author. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′–3′) a Purpose 1F cggatc gacgtc TAATACGACTCACTATAG AGTTGTTGATCTGTGTGAGTCAGACTGCG Amplification of fragment A 5030R gagccg tcgcga GGATCGGAGATCCTGAGGTC CCTGCAGG GTAGT Amplification of fragment A 5003F ctctggactac CCTGCAGG GACGTCCGGAAGTCCGATCCTAGACAAATGTGG Amplification of fragment B 7190R catcattagca tcgcga CTCCAAGGTCCC ATGCAT AAAATGG Amplification of fragment B 7006F CATTGATCTGCGGCCAGC Amplification of fragment C 8860R gttgat tcgcga TTCTTTGGTGCAG ACGCGT GGCCGC Amplification of fragment C 8584F CCATGGGAGCTACGAAGC Amplification of fragment D 10807R gagact tcgcgagcgcgc AGAAACCATGGATTTCCCCACACCGGCCGCCGAAGTTCG GCGATCTGTGCCTGGC Amplification of fragment D POL-6126F CCTCGCTCTATCGG CCTGAGG CCGATAAG Polymerase mutation POL-9709R gacact CCTGAGG GCATGTGCAAACCTATCATCGATTGGCTTCACAACGCAGG CAGCTGCACTGACCGCCATTCGTTTG Polymerase mutation PJAZZ-10222F GCCCACCCGAAGGTGAG Glycosylation mutation GLY-1467R CTATTTTCGTCAGTTTCATATCCAATCATCCCGCTATGC VNDT deletion N154A CAGTTTCATATCCTGTATCAGCGACAATCATCCCGCTATG Glycosylation mutation GLY-3302R CTTCACTGTGCCATGGC Glycosylation mutation Tag-3902F GCTCTTGAAGGTGACTTG Detection of genetic tag Tag-5723R CATTTCCGTTTCTCACGC Detection of genetic tag Open in a separate window a Restriction enzyme sites are underlined. ..
Mutagenesis:Article Title: Zika Virus Encoding Nonglycosylated Envelope Protein Is Attenuated and Defective in Neuroinvasion
Article Snippet: The plasmid, which contains an inducible origin of replication from phage N15, can be maintained at approximately 2 to 4 copies/cell in the BigEasy TSA host strain (Lucigen Corporation). .. Further details of the BigEasy TSA host strain can be obtained from Lucigen Corporation or from the corresponding author. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′–3′) a Purpose 1F cggatc gacgtc TAATACGACTCACTATAG AGTTGTTGATCTGTGTGAGTCAGACTGCG Amplification of fragment A 5030R gagccg tcgcga GGATCGGAGATCCTGAGGTC CCTGCAGG GTAGT Amplification of fragment A 5003F ctctggactac CCTGCAGG GACGTCCGGAAGTCCGATCCTAGACAAATGTGG Amplification of fragment B 7190R catcattagca tcgcga CTCCAAGGTCCC ATGCAT AAAATGG Amplification of fragment B 7006F CATTGATCTGCGGCCAGC Amplification of fragment C 8860R gttgat tcgcga TTCTTTGGTGCAG ACGCGT GGCCGC Amplification of fragment C 8584F CCATGGGAGCTACGAAGC Amplification of fragment D 10807R gagact tcgcgagcgcgc AGAAACCATGGATTTCCCCACACCGGCCGCCGAAGTTCG GCGATCTGTGCCTGGC Amplification of fragment D POL-6126F CCTCGCTCTATCGG CCTGAGG CCGATAAG Polymerase mutation POL-9709R gacact CCTGAGG GCATGTGCAAACCTATCATCGATTGGCTTCACAACGCAGG CAGCTGCACTGACCGCCATTCGTTTG Polymerase mutation PJAZZ-10222F GCCCACCCGAAGGTGAG Glycosylation mutation GLY-1467R CTATTTTCGTCAGTTTCATATCCAATCATCCCGCTATGC VNDT deletion N154A CAGTTTCATATCCTGTATCAGCGACAATCATCCCGCTATG Glycosylation mutation GLY-3302R CTTCACTGTGCCATGGC Glycosylation mutation Tag-3902F GCTCTTGAAGGTGACTTG Detection of genetic tag Tag-5723R CATTTCCGTTTCTCACGC Detection of genetic tag Open in a separate window a Restriction enzyme sites are underlined. ..
Glycoproteomics:Article Title: Zika Virus Encoding Nonglycosylated Envelope Protein Is Attenuated and Defective in Neuroinvasion
Article Snippet: The plasmid, which contains an inducible origin of replication from phage N15, can be maintained at approximately 2 to 4 copies/cell in the BigEasy TSA host strain (Lucigen Corporation). .. Further details of the BigEasy TSA host strain can be obtained from Lucigen Corporation or from the corresponding author. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′–3′) a Purpose 1F cggatc gacgtc TAATACGACTCACTATAG AGTTGTTGATCTGTGTGAGTCAGACTGCG Amplification of fragment A 5030R gagccg tcgcga GGATCGGAGATCCTGAGGTC CCTGCAGG GTAGT Amplification of fragment A 5003F ctctggactac CCTGCAGG GACGTCCGGAAGTCCGATCCTAGACAAATGTGG Amplification of fragment B 7190R catcattagca tcgcga CTCCAAGGTCCC ATGCAT AAAATGG Amplification of fragment B 7006F CATTGATCTGCGGCCAGC Amplification of fragment C 8860R gttgat tcgcga TTCTTTGGTGCAG ACGCGT GGCCGC Amplification of fragment C 8584F CCATGGGAGCTACGAAGC Amplification of fragment D 10807R gagact tcgcgagcgcgc AGAAACCATGGATTTCCCCACACCGGCCGCCGAAGTTCG GCGATCTGTGCCTGGC Amplification of fragment D POL-6126F CCTCGCTCTATCGG CCTGAGG CCGATAAG Polymerase mutation POL-9709R gacact CCTGAGG GCATGTGCAAACCTATCATCGATTGGCTTCACAACGCAGG CAGCTGCACTGACCGCCATTCGTTTG Polymerase mutation PJAZZ-10222F GCCCACCCGAAGGTGAG Glycosylation mutation GLY-1467R CTATTTTCGTCAGTTTCATATCCAATCATCCCGCTATGC VNDT deletion N154A CAGTTTCATATCCTGTATCAGCGACAATCATCCCGCTATG Glycosylation mutation GLY-3302R CTTCACTGTGCCATGGC Glycosylation mutation Tag-3902F GCTCTTGAAGGTGACTTG Detection of genetic tag Tag-5723R CATTTCCGTTTCTCACGC Detection of genetic tag Open in a separate window a Restriction enzyme sites are underlined. ..
|
